| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-04-06 06:03:15 |
| Analysis completed | 2025-04-06 06:03:15 |
| Wall time | 0:0:0 hours |
| locus | COI |
| preliminary_id | Empoascanara |
| taxa_of_interest |
Empoascanara |
| country | Australia |
| host | Urina |
| sample_id | MG240613_4 |
| Query DNA sequence |
>MG240613_4 ATATTGGAACAATATATTTTATTTTTGGTGTTTGATCTGGAATTGTAGGTATAATGTTAA GTATATTAATTCGAATTGAATTAGCTCAGCCTGGGGCATTTTTAGCAAACGACCAATTAT ATAATGTAATTGTTACATCACATGCATTTATTATGATTTTTTTTATAGTTATACCAATTA TAATTGGAGGTTTTGGTAATTGATTATTACCTCTAATAATTGGAGCACCTGATATAGCAT TCCCTCGAATAAATAATATAAGATTCTGGCTTTTACCACCCTCATTAACCTTACTAATAT TAAGTTCAATAGTAGAAATAGGAGCTGGAACCGGATGAACAGTTTATCCTCCTTTATCTT CTAATATTGCTCATTCAGGAGCAAGAGTAGATTTAGCTATTTTTTCATTACATTTAGCTG GTATTTCCTCGATTTTAGGAGCAGTAAATTTTATTACAACAGTAATTAATATGCGTTCTG AAATATTAACACTTGACCGTATTCCTTTATTTGTTTGGTCAGTTCTAATTACAGCTGTTC TTTTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACAATATTACTGACAGATCGAA ATTTGAATACTACTTTCTTTGATCCATCAGGAGGGGGGGATCCAATTTTGTACCAACATC TATTCTGA
Inconclusive
Identification not possible (potential unknown species).
Reasoning - Flag 1E:
No candidate species matched.
| Preliminary morphology ID confirmed | NA |
|
Inconclusive taxonomic identity (Flag 1E) |
|
| Taxa of interest ruled out | False |
|
Flag 2A: Taxon of interest NOT detected Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2C: ≤10% of taxon have reference sequence(s) at the given locus |
|
Flag 1E:
Identification not possible (potential unknown species)
No candidate species matched
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits are then classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 0 | 0 |
| MODERATE MATCH | ≥ 93.5% | 0 | 0 |
| NO MATCH | < 93.5% |
Hits per candidate species (top 10 candidates only)
| Species | Hits | Identity | E-value |
|---|
| # | Accession | Hit subject | Align length | Query coverage | Score | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | JQ344519 | Hemiptera sp. hongheHap_160 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 346.0 | 1.13e-178 | 85.5% |
| 2 | PP786535 | Aulacizes conspersa voucher ENT5995 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 579 | 86.7% | 318.0 | 4.15e-163 | 85.1% |
| 3 | JQ344979 | Hemiptera sp. KMGHap_131 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 328.0 | 1.14e-168 | 84.6% |
| 4 | OQ389576 | Zygina rhamni isolate Haplotype 10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 350.0 | 0.00e+00 | 84.5% |
| 5 | MN972664 | Arboridia kakogawana voucher 736 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 632 | 94.6% | 338.0 | 3.16e-174 | 84.5% |
| 6 | OQ389571 | Zygina rhamni isolate Haplotype 5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 347.0 | 3.14e-179 | 84.4% |
| 7 | OQ389573 | Zygina rhamni isolate Haplotype 7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 347.0 | 3.14e-179 | 84.4% |
| 8 | OM595136 | Cicadellidae sp. voucher BIOUG13156-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 346.0 | 1.13e-178 | 84.4% |
| 9 | MN972667 | Arboridia kakogawana voucher 768 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 632 | 94.6% | 335.0 | 1.47e-172 | 84.4% |
| 10 | MN972665 | Arboridia kakogawana voucher 767 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 632 | 94.6% | 335.0 | 1.47e-172 | 84.4% |
| 11 | MN972663 | Arboridia kakogawana voucher 769 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 632 | 94.6% | 335.0 | 1.47e-172 | 84.4% |
| 12 | MN972662 | Arboridia kakogawana voucher 696 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 632 | 94.6% | 335.0 | 1.47e-172 | 84.4% |
| 13 | JQ344978 | Hemiptera sp. KMGHap_130 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 325.0 | 5.33e-167 | 84.4% |
| 14 | KJ089014 | Erythroneura sp. BOLD:ACA5193 voucher BIOUG02977-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 344.0 | 1.46e-177 | 84.3% |
| 15 | OQ389574 | Zygina rhamni isolate Haplotype 8 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 344.0 | 1.46e-177 | 84.2% |
| 16 | OQ389570 | Zygina rhamni isolate Haplotype 4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 344.0 | 1.46e-177 | 84.2% |
| 17 | MN972669 | Arboridia kakogawana voucher 766 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 632 | 94.6% | 332.0 | 6.84e-171 | 84.2% |
| 18 | MN972668 | Arboridia kakogawana voucher 697 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 632 | 94.6% | 332.0 | 6.84e-171 | 84.2% |
| 19 | MN972661 | Arboridia kakogawana voucher 695 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 628 | 94.0% | 329.0 | 3.18e-169 | 84.2% |
| 20 | KR036479 | Erythroneura rubrella voucher BIOUG01643-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 323.0 | 6.89e-166 | 84.2% |
| 21 | KR577309 | Erythroneura rubrella voucher BIOUG05893-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 318.0 | 4.15e-163 | 84.2% |
| 22 | OQ389575 | Zygina rhamni isolate Haplotype 9 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 341.0 | 6.79e-176 | 84.1% |
| 23 | OQ389568 | Zygina rhamni isolate Haplotype 2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 341.0 | 6.79e-176 | 84.1% |
| 24 | OQ389569 | Zygina rhamni isolate Haplotype 3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 341.0 | 6.79e-176 | 84.1% |
| 25 | OQ389572 | Zygina rhamni isolate Haplotype 6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 341.0 | 6.79e-176 | 84.1% |
| 26 | KJ163218 | Erythroneura rubrella voucher BIOUG03447-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 321.0 | 8.91e-165 | 84.1% |
| 27 | KJ163052 | Erythroneura rubrella voucher BIOUG03686-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 321.0 | 8.91e-165 | 84.1% |
| 28 | KJ164727 | Erythroneura rubrella voucher BIOUG03516-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 321.0 | 8.91e-165 | 84.1% |
| 29 | KJ163115 | Erythroneura rubrella voucher BIOUG03685-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 321.0 | 8.91e-165 | 84.1% |
| 30 | KJ167946 | Erythroneura rubrella voucher BIOUG03685-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 321.0 | 8.91e-165 | 84.1% |
| 31 | KJ087875 | Erythroneura rubrella voucher BIOUG03040-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 321.0 | 8.91e-165 | 84.1% |
| 32 | KJ085185 | Erythroneura rubrella voucher BIOUG02993-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 321.0 | 8.91e-165 | 84.1% |
| 33 | KJ165946 | Erythroneura rubrella voucher BIOUG03443-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 320.0 | 3.21e-164 | 84.1% |
| 34 | KR033747 | Erythroneura rubrella voucher BIOUG00936-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 315.0 | 1.93e-161 | 84.1% |
| 35 | KR569744 | Erythroneura rubrella voucher BIOUG05894-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 315.0 | 1.93e-161 | 84.1% |
| 36 | KJ166510 | Erythroneura rubrella voucher BIOUG03685-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 315.0 | 1.93e-161 | 84.1% |
| 37 | KR035997 | Erythroneura vitifex voucher BIOUG02717-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 315.0 | 1.93e-161 | 84.1% |
| 38 | KR582968 | Erythroneura rubrella voucher BIOUG05894-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 315.0 | 1.93e-161 | 84.1% |
| 39 | KR575372 | Erythroneura rubrella voucher BIOUG05894-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 315.0 | 1.93e-161 | 84.1% |
| 40 | KJ164022 | Erythroneura rubrella voucher BIOUG03637-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 315.0 | 1.93e-161 | 84.1% |
| 41 | KJ163497 | Erythroneura rubrella voucher BIOUG03685-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 315.0 | 1.93e-161 | 84.1% |
| 42 | KR043199 | Erythroneura rubrella voucher BIOUG01595-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 340.0 | 2.44e-175 | 84.0% |
| 43 | KR033347 | Erythroneura rubrella voucher BIOUG00936-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 339.0 | 8.79e-175 | 84.0% |
| 44 | KJ445634 | Erythroneura rubrella voucher BIOUG03768-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 339.0 | 8.79e-175 | 84.0% |
| 45 | MN972666 | Arboridia kakogawana voucher 735 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 632 | 94.6% | 329.0 | 3.18e-169 | 84.0% |
| 46 | KJ083392 | Erythroneura rubrella voucher BIOUG02999-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 327.0 | 4.12e-168 | 84.0% |
| 47 | KJ167762 | Erythroneura rubrella voucher BIOUG03637-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 327.0 | 4.12e-168 | 84.0% |
| 48 | KR583346 | Erythroneura rubrella voucher BIOUG05894-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 327.0 | 4.12e-168 | 84.0% |
| 49 | KJ166796 | Erythroneura rubrella voucher BIOUG03639-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 326.0 | 1.48e-167 | 84.0% |
| 50 | OM598528 | Cicadellidae sp. voucher BIOUG13318-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 625 | 93.6% | 325.0 | 5.33e-167 | 84.0% |
| 51 | KJ083566 | Erythroneura rubrella voucher BIOUG02961-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 324.0 | 1.92e-166 | 84.0% |
| 52 | KJ090783 | Erythroneura rubrella voucher BIOUG02997-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 324.0 | 1.92e-166 | 84.0% |
| 53 | KJ085705 | Erythroneura rubrella voucher BIOUG02991-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 324.0 | 1.92e-166 | 84.0% |
| 54 | KJ165149 | Erythroneura rubrella voucher BIOUG03634-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 324.0 | 1.92e-166 | 84.0% |
| 55 | KR573100 | Erythroneura rubrella voucher BIOUG05893-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 320.0 | 3.21e-164 | 84.0% |
| 56 | KR564118 | Erythroneura rubrella voucher BIOUG05893-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 319.0 | 1.15e-163 | 84.0% |
| 57 | KR569014 | Erythroneura rubrella voucher BIOUG05893-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 318.0 | 4.15e-163 | 84.0% |
| 58 | KJ087232 | Erythroneura rubrella voucher BIOUG02944-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 318.0 | 4.15e-163 | 84.0% |
| 59 | KF919344 | Draeculacephala crassicornis voucher CNC#HEM400208 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 338.0 | 3.16e-174 | 83.9% |
| 60 | HM907509 | Hemiptera sp. BOLD:AAG8686 voucher CHUCD-0036 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 338.0 | 3.16e-174 | 83.9% |
| 61 | OQ389567 | Zygina rhamni isolate Haplotype 1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 338.0 | 3.16e-174 | 83.9% |
| 62 | KR031431 | Erythroneura rubrella voucher BIOUG00891-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 336.0 | 4.09e-173 | 83.9% |
| 63 | MF933841 | Erythroneura rubrella voucher BIOUG20537-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 641 | 96.0% | 332.0 | 6.84e-171 | 83.9% |
| 64 | KJ164263 | Erythroneura rubrella voucher BIOUG03637-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 94.9% | 328.0 | 1.14e-168 | 83.9% |
| 65 | KJ085073 | Erythroneura rubrella voucher BIOUG02994-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 622 | 93.1% | 322.0 | 2.48e-165 | 83.9% |
| 66 | KR568083 | Cicadellidae sp. BOLD:ABA5787 voucher BIOUG13597-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 622 | 93.1% | 322.0 | 2.48e-165 | 83.9% |
| 67 | KJ165815 | Erythroneura rubrella voucher BIOUG03686-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 319.0 | 1.15e-163 | 83.9% |
| 68 | KJ167811 | Erythroneura rubrella voucher BIOUG03634-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 318.0 | 4.15e-163 | 83.9% |
| 69 | KJ086749 | Erythroneura rubrella voucher BIOUG02961-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 318.0 | 4.15e-163 | 83.9% |
| 70 | KJ164984 | Erythroneura rubrella voucher BIOUG03734-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 318.0 | 4.15e-163 | 83.9% |
| 71 | KJ164398 | Erythroneura rubrella voucher BIOUG03516-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 318.0 | 4.15e-163 | 83.9% |
| 72 | KJ091185 | Erythroneura rubrella voucher BIOUG02977-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 318.0 | 4.15e-163 | 83.9% |
| 73 | KJ167667 | Erythroneura rubrella voucher BIOUG03686-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 318.0 | 4.15e-163 | 83.9% |
| 74 | KJ165495 | Erythroneura rubrella voucher BIOUG03734-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 318.0 | 4.15e-163 | 83.9% |
| 75 | KJ089290 | Erythroneura rubrella voucher BIOUG03443-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 318.0 | 4.15e-163 | 83.9% |
| 76 | KJ164235 | Erythroneura sp. BOLD:ABA5847 voucher BIOUG02944-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 317.0 | 1.49e-162 | 83.9% |
| 77 | KJ083823 | Erythroneura rubrella voucher BIOUG03439-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 317.0 | 1.49e-162 | 83.9% |
| 78 | KR566289 | Erythroneura rubrella voucher BIOUG05894-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 312.0 | 8.97e-160 | 83.9% |
| 79 | OP643509 | Seriana bacilla isolate guiyang cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.7% | 342.0 | 1.89e-176 | 83.8% |
| 80 | KR031694 | Erythroneura certa voucher BIOUG00947-A02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 338.0 | 3.16e-174 | 83.8% |
| 81 | KR575935 | Eratoneura certa voucher BIOUG00917-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 338.0 | 3.16e-174 | 83.8% |
| 82 | KR573520 | Cicadellidae sp. BOLD-2016 voucher BIOUG00891-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 336.0 | 4.09e-173 | 83.8% |
| 83 | HM907511 | Hemiptera sp. BOLD:AAG8686 voucher CHUCD-0039 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 335.0 | 1.47e-172 | 83.8% |
| 84 | MZ607058 | Zygina hyperici voucher TR1117 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 335.0 | 1.47e-172 | 83.8% |
| 85 | KR579809 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG01755-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 333.0 | 1.90e-171 | 83.8% |
| 86 | KR033740 | Erythroneura vitifex voucher BIOUG01139-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 638 | 95.5% | 326.0 | 1.48e-167 | 83.8% |
| 87 | KR573177 | Erythroneura rubrella voucher BIOUG05893-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 325.0 | 5.33e-167 | 83.8% |
| 88 | KJ087231 | Erythroneura rubrella voucher BIOUG03340-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 324.0 | 1.92e-166 | 83.8% |
| 89 | KJ163291 | Erythroneura rubrella voucher BIOUG03640-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 324.0 | 1.92e-166 | 83.8% |
| 90 | KR033066 | Erythroneura rubrella voucher BIOUG04225-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 324.0 | 1.92e-166 | 83.8% |
| 91 | KR038813 | Erythroneura rubrella voucher BIOUG04225-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 324.0 | 1.92e-166 | 83.8% |
| 92 | KJ085143 | Erythroneura rubrella voucher BIOUG03342-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 324.0 | 1.92e-166 | 83.8% |
| 93 | KJ086808 | Erythroneura rubrella voucher BIOUG02980-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 324.0 | 1.92e-166 | 83.8% |
| 94 | KJ167767 | Erythroneura rubrella voucher BIOUG03635-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 324.0 | 1.92e-166 | 83.8% |
| 95 | KR561667 | Erythroneura rubrella voucher BIOUG05894-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 628 | 94.0% | 322.0 | 2.48e-165 | 83.8% |
| 96 | KJ092276 | Erythroneura rubrella voucher BIOUG02991-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 321.0 | 8.91e-165 | 83.8% |
| 97 | KJ086283 | Erythroneura rubrella voucher BIOUG02961-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 321.0 | 8.91e-165 | 83.8% |
| 98 | KR044111 | Erythroneura rubrella voucher BIOUG03716-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 628 | 94.0% | 321.0 | 8.91e-165 | 83.8% |
| 99 | KJ089610 | Erythroneura rubrella voucher BIOUG02993-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 321.0 | 8.91e-165 | 83.8% |
| 100 | KJ092683 | Erythroneura rubrella voucher BIOUG02991-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 321.0 | 8.91e-165 | 83.8% |
| 101 | KJ084812 | Erythroneura rubrella voucher BIOUG02966-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 622 | 93.1% | 319.0 | 1.15e-163 | 83.8% |
| 102 | KR043105 | Erythroneura vitifex voucher BIOUG02715-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 93.0% | 318.0 | 4.15e-163 | 83.8% |
| 103 | KR570539 | Eratoneura certa voucher BIOUG02504-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 617 | 92.4% | 317.0 | 1.49e-162 | 83.8% |
| 104 | KR582608 | Erythroneura rubrella voucher BIOUG05894-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 316.0 | 5.36e-162 | 83.8% |
| 105 | KR564902 | Erythroneura rubrella voucher BIOUG05893-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 316.0 | 5.36e-162 | 83.8% |
| 106 | KR564225 | Erythroneura rubrella voucher BIOUG05894-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 315.0 | 1.93e-161 | 83.8% |
| 107 | KJ088090 | Erythroneura rubrella voucher BIOUG02944-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 315.0 | 1.93e-161 | 83.8% |
| 108 | KR045249 | Erythroneura vitifex voucher BIOUG01139-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 311.0 | 3.23e-159 | 83.8% |
| 109 | MG401666 | Erythroneura elegans voucher BIOUG22015-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 310.0 | 1.16e-158 | 83.8% |
| 110 | MG398046 | Eratoneura certa voucher BIOUG21966-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 335.0 | 1.47e-172 | 83.7% |
| 111 | KR567542 | Eratoneura certa voucher BIOUG00935-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 335.0 | 1.47e-172 | 83.7% |
| 112 | KR033646 | Erythroneura rubrella voucher BIOUG00936-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 333.0 | 1.90e-171 | 83.7% |
| 113 | KR040278 | Erythroneura rubrella voucher BIOUG00906-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 333.0 | 1.90e-171 | 83.7% |
| 114 | KR044612 | Erythroneura rubrella voucher BIOUG00936-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 333.0 | 1.90e-171 | 83.7% |
| 115 | KR031669 | Erythroneura rubrella voucher BIOUG00917-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 333.0 | 1.90e-171 | 83.7% |
| 116 | KR344082 | Erythroneura rubrella voucher BIOUG10644-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 333.0 | 1.90e-171 | 83.7% |
| 117 | KR033796 | Erythroneura rubrella voucher BIOUG01295-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 333.0 | 1.90e-171 | 83.7% |
| 118 | MW301812 | Arboridia sp. isolate Yal-1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 654 | 97.9% | 333.0 | 1.90e-171 | 83.7% |
| 119 | MZ632615 | Zygina hyperici voucher TR1116 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 332.0 | 6.84e-171 | 83.7% |
| 120 | KF919545 | Neokolla severini voucher CNC#HEM401126 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.7% | 328.0 | 1.14e-168 | 83.7% |
| 121 | KJ091963 | Erythroneura rubrella voucher BIOUG02983-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 637 | 95.4% | 325.0 | 5.33e-167 | 83.7% |
| 122 | KJ084734 | Erythroneura rubrella voucher BIOUG03443-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 322.0 | 2.48e-165 | 83.7% |
| 123 | KJ090181 | Erythroneura rubrella voucher BIOUG02996-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 321.0 | 8.91e-165 | 83.7% |
| 124 | KJ167858 | Erythroneura rubrella voucher BIOUG03686-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 315.0 | 1.93e-161 | 83.7% |
| 125 | KJ163380 | Erythroneura rubrella voucher BIOUG03686-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 315.0 | 1.93e-161 | 83.7% |
| 126 | KJ164975 | Erythroneura rubrella voucher BIOUG02997-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 315.0 | 1.93e-161 | 83.7% |
| 127 | KJ166640 | Erythroneura rubrella voucher BIOUG03564-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 315.0 | 1.93e-161 | 83.7% |
| 128 | KR578381 | Erythroneura rubrella voucher BIOUG05893-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 314.0 | 6.94e-161 | 83.7% |
| 129 | KR564220 | Erythroneura rubrella voucher BIOUG05893-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 314.0 | 6.94e-161 | 83.7% |
| 130 | KR560483 | Erythroneura rubrella voucher BIOUG05893-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 313.0 | 2.50e-160 | 83.7% |
| 131 | KR565480 | Erythroneura rubrella voucher BIOUG05893-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 313.0 | 2.50e-160 | 83.7% |
| 132 | KJ167330 | Erythroneura rubrella voucher BIOUG03685-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 312.0 | 8.97e-160 | 83.7% |
| 133 | NC_070002 | Sahlbergotettix salicicola mitochondrion, complete genome | 668 | 100.0% | 338.0 | 3.16e-174 | 83.6% |
| 134 | KJ209071 | Erythroneura rubrella voucher BIOUG03739-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 335.0 | 1.47e-172 | 83.6% |
| 135 | KY830563 | Cicadellidae sp. BIOUG04904-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 333.0 | 1.90e-171 | 83.6% |
| 136 | HM906804 | Sibovia sp. n. CCM069-10 voucher PT1_JRE_0069 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 332.0 | 6.84e-171 | 83.6% |
| 137 | KF919407 | Draeculacephala crassicornis voucher CNC#HEM400227 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 332.0 | 6.84e-171 | 83.6% |
| 138 | KR031417 | Erythroneura rubrella voucher BIOUG00891-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 330.0 | 8.85e-170 | 83.6% |
| 139 | KJ085061 | Erythroneura rubrella voucher BIOUG02977-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 330.0 | 8.85e-170 | 83.6% |
| 140 | KR570869 | Eratoneura sp. BOLD-2016 voucher BIOUG01790-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 329.0 | 3.18e-169 | 83.6% |
| 141 | KR581679 | Eratoneura sp. BOLD-2016 voucher BIOUG01755-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 329.0 | 3.18e-169 | 83.6% |
| 142 | KR039384 | Erythroneura vitifex voucher BIOUG00941-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 324.0 | 1.92e-166 | 83.6% |
| 143 | KR043338 | Erythroneura vitifex voucher BIOUG01139-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 324.0 | 1.92e-166 | 83.6% |
| 144 | KR036932 | Erythroneura vitifex voucher BIOUG00941-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 324.0 | 1.92e-166 | 83.6% |
| 145 | KR035579 | Erythroneura vitifex voucher BIOUG01139-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 324.0 | 1.92e-166 | 83.6% |
| 146 | KR569534 | Erythroneura vitifex voucher BIOUG00941-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 638 | 95.5% | 323.0 | 6.89e-166 | 83.6% |
| 147 | KJ163323 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03516-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 319.0 | 1.15e-163 | 83.6% |
| 148 | KR042048 | Erythroneura vitifex voucher BIOUG02718-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 93.0% | 315.0 | 1.93e-161 | 83.6% |
| 149 | KR034503 | Erythroneura vitifex voucher BIOUG02504-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 93.0% | 315.0 | 1.93e-161 | 83.6% |
| 150 | KR040582 | Erythroneura vitifex voucher BIOUG02504-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.8% | 314.0 | 6.94e-161 | 83.6% |
| 151 | KJ090069 | Erythroneura rubrella voucher BIOUG03000-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 312.0 | 8.97e-160 | 83.6% |
| 152 | KR031096 | Erythroneura rubrella voucher BIOUG02718-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 312.0 | 8.97e-160 | 83.6% |
| 153 | KJ090874 | Erythroneura rubrella voucher BIOUG03000-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 312.0 | 8.97e-160 | 83.6% |
| 154 | KR034201 | Erythroneura rubrella voucher BIOUG02517-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 615 | 92.1% | 312.0 | 8.97e-160 | 83.6% |
| 155 | KJ085257 | Erythroneura rubrella voucher BIOUG02977-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 311.0 | 3.23e-159 | 83.6% |
| 156 | KR043893 | Erythroneura rubrella voucher BIOUG02716-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 311.0 | 3.23e-159 | 83.6% |
| 157 | KR578359 | Erythroneura rubrella voucher BIOUG05894-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 311.0 | 3.23e-159 | 83.6% |
| 158 | KJ091634 | Erythroneura rubrella voucher BIOUG02986-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 311.0 | 3.23e-159 | 83.6% |
| 159 | KR578464 | Erythroneura bakeri voucher BIOUG00936-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 329.0 | 3.18e-169 | 83.5% |
| 160 | KJ089173 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03447-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 327.0 | 4.12e-168 | 83.5% |
| 161 | KJ083814 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02999-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 327.0 | 4.12e-168 | 83.5% |
| 162 | KR560629 | Erythroneura vitifex voucher BIOUG00941-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 97.0% | 327.0 | 4.12e-168 | 83.5% |
| 163 | KR043463 | Erythroneura vitifex voucher BIOUG01297-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.9% | 326.0 | 1.48e-167 | 83.5% |
| 164 | KJ445502 | Erythroneura rubrella voucher BIOUG03768-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 637 | 95.4% | 322.0 | 2.48e-165 | 83.5% |
| 165 | MG404656 | Eratoneura sp. BIOUG00906-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 321.0 | 8.91e-165 | 83.5% |
| 166 | KR034220 | Erythroneura vitifex voucher BIOUG01139-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 321.0 | 8.91e-165 | 83.5% |
| 167 | KR031607 | Erythroneura vitifex voucher BIOUG01308-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 321.0 | 8.91e-165 | 83.5% |
| 168 | KJ167281 | Erythroneura rubrella voucher BIOUG02996-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 319.0 | 1.15e-163 | 83.5% |
| 169 | KJ090014 | Erythroneura rubrella voucher BIOUG02983-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 318.0 | 4.15e-163 | 83.5% |
| 170 | KR030724 | Erythroneura rubrella voucher BIOUG02602-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 318.0 | 4.15e-163 | 83.5% |
| 171 | KR040164 | Erythroneura rubrella voucher BIOUG02715-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 318.0 | 4.15e-163 | 83.5% |
| 172 | KJ207659 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03903-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 94.8% | 318.0 | 4.15e-163 | 83.5% |
| 173 | KJ091199 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02999-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 318.0 | 4.15e-163 | 83.5% |
| 174 | KJ163296 | Erythroneura rubrella voucher BIOUG03000-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 318.0 | 4.15e-163 | 83.5% |
| 175 | KJ092216 | Erythroneura rubrella voucher BIOUG02990-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 318.0 | 4.15e-163 | 83.5% |
| 176 | KJ084327 | Erythroneura rubrella voucher BIOUG02996-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 318.0 | 4.15e-163 | 83.5% |
| 177 | KR566607 | Erythroneura rubrella voucher BIOUG05894-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 318.0 | 4.15e-163 | 83.5% |
| 178 | KR036693 | Erythroneura rubrella voucher BIOUG02716-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 317.0 | 1.49e-162 | 83.5% |
| 179 | KR042005 | Erythroneura rubrella voucher BIOUG02717-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 317.0 | 1.49e-162 | 83.5% |
| 180 | KR032197 | Erythroneura vitifex voucher BIOUG01516-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 94.2% | 317.0 | 1.49e-162 | 83.5% |
| 181 | KR571881 | Erythroneura rubrella voucher BIOUG05893-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 94.2% | 317.0 | 1.49e-162 | 83.5% |
| 182 | KR031745 | Erythroneura vitifex voucher BIOUG02636-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 315.0 | 1.93e-161 | 83.5% |
| 183 | KR043216 | Erythroneura rubrella voucher BIOUG02517-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 315.0 | 1.93e-161 | 83.5% |
| 184 | KJ165508 | Erythroneura rubrella voucher BIOUG03040-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 315.0 | 1.93e-161 | 83.5% |
| 185 | KR576835 | Cicadellidae sp. BOLD:ABA5798 voucher BIOUG08326-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 315.0 | 1.93e-161 | 83.5% |
| 186 | KR040671 | Erythroneura vitifex voucher BIOUG02636-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 315.0 | 1.93e-161 | 83.5% |
| 187 | KR044941 | Erythroneura vitifex voucher BIOUG02718-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 315.0 | 1.93e-161 | 83.5% |
| 188 | KJ088637 | Erythroneura rubrella voucher BIOUG02991-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 315.0 | 1.93e-161 | 83.5% |
| 189 | KJ089985 | Erythroneura rubrella voucher BIOUG02994-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 315.0 | 1.93e-161 | 83.5% |
| 190 | KR032937 | Erythroneura vitifex voucher BIOUG02718-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 314.0 | 6.94e-161 | 83.5% |
| 191 | MG398430 | Dikraneura sp. BIOUG22038-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 314.0 | 6.94e-161 | 83.5% |
| 192 | KR039064 | Erythroneura vitifex voucher BIOUG02715-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 93.0% | 312.0 | 8.97e-160 | 83.5% |
| 193 | KR031017 | Erythroneura vitifex voucher BIOUG02636-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 93.0% | 312.0 | 8.97e-160 | 83.5% |
| 194 | KR032789 | Erythroneura vitifex voucher BIOUG02718-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 621 | 93.0% | 312.0 | 8.97e-160 | 83.5% |
| 195 | KJ091708 | Erythroneura rubrella voucher BIOUG03000-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 310.0 | 1.16e-158 | 83.5% |
| 196 | KJ165581 | Erythroneura rubrella voucher BIOUG02986-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 310.0 | 1.16e-158 | 83.5% |
| 197 | KR581535 | Erythroneura rubrella voucher BIOUG05894-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 613 | 91.8% | 310.0 | 1.16e-158 | 83.5% |
| 198 | PQ068593 | Chudania sinica mitochondrion, complete genome | 668 | 100.0% | 335.0 | 1.47e-172 | 83.4% |
| 199 | OP643511 | Seriana bacilla isolate shibing cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.7% | 333.0 | 1.90e-171 | 83.4% |
| 200 | PP596073 | Collessius macfarlanei isolate MD020 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 329.0 | 3.18e-169 | 83.4% |
| 201 | KR567403 | Cicadellidae sp. BOLD:AAV0164 voucher BIOUG01595-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 327.0 | 4.12e-168 | 83.4% |
| 202 | KR567787 | Eratoneura sp. BOLD-2016 voucher BIOUG01296-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 326.0 | 1.48e-167 | 83.4% |
| 203 | JF867886 | Coenosia sp. BBDCN360-10 voucher BIOUG| 652 |
97.6% |
325.0 |
5.33e-167 |
83.4% |
|
| 204 | KR042095 | Erythroneura vitifex voucher BIOUG01296-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 97.0% | 324.0 | 1.92e-166 | 83.4% |
| 205 | KR030596 | Erythroneura vitifex voucher BIOUG01516-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 97.0% | 324.0 | 1.92e-166 | 83.4% |
| 206 | KF919519 | Neokolla severini voucher CNC#HEM401120 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.7% | 322.0 | 2.48e-165 | 83.4% |
| 207 | KR039332 | Erythroneura vitifex voucher BIOUG00935-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 638 | 95.5% | 320.0 | 3.21e-164 | 83.4% |
| 208 | KF919372 | Draeculacephala soluta voucher CNC#HEM401032 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 635 | 95.1% | 317.0 | 1.49e-162 | 83.4% |
| 209 | KJ085990 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02980-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 316.0 | 5.36e-162 | 83.4% |
| 210 | KJ167407 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03635-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 316.0 | 5.36e-162 | 83.4% |
| 211 | KJ163076 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03637-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 316.0 | 5.36e-162 | 83.4% |
| 212 | KJ163275 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03516-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 316.0 | 5.36e-162 | 83.4% |
| 213 | KJ164498 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03639-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 316.0 | 5.36e-162 | 83.4% |
| 214 | KJ163540 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02983-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 316.0 | 5.36e-162 | 83.4% |
| 215 | KR564089 | Dikraneura sp. BOLD-2016 voucher BIOUG03971-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 634 | 94.9% | 316.0 | 5.36e-162 | 83.4% |
| 216 | KR033663 | Erythroneura vitifex voucher BIOUG02715-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 315.0 | 1.93e-161 | 83.4% |
| 217 | KJ167943 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03635-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 315.0 | 1.93e-161 | 83.4% |
| 218 | MF937352 | Erythroneura sp. BIOUG20490-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 315.0 | 1.93e-161 | 83.4% |
| 219 | KR043814 | Erythroneura rubrella voucher BIOUG02718-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 628 | 94.0% | 315.0 | 1.93e-161 | 83.4% |
| 220 | MG398523 | Dikraneura sp. BIOUG31106-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 315.0 | 1.93e-161 | 83.4% |
| 221 | KR036749 | Erythroneura vitifex voucher BIOUG02715-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 94.2% | 314.0 | 6.94e-161 | 83.4% |
| 222 | KJ085617 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02996-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 94.2% | 314.0 | 6.94e-161 | 83.4% |
| 223 | KJ085974 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03000-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 94.2% | 314.0 | 6.94e-161 | 83.4% |
| 224 | KJ086122 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02977-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 313.0 | 2.50e-160 | 83.4% |
| 225 | KJ166779 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03634-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 313.0 | 2.50e-160 | 83.4% |
| 226 | KJ167221 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03634-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 312.0 | 8.97e-160 | 83.4% |
| 227 | KJ088456 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03443-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 312.0 | 8.97e-160 | 83.4% |
| 228 | KJ093064 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02966-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 312.0 | 8.97e-160 | 83.4% |
| 229 | KJ092129 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02996-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 312.0 | 8.97e-160 | 83.4% |
| 230 | KR038735 | Erythroneura vitifex voucher BIOUG02715-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.8% | 311.0 | 3.23e-159 | 83.4% |
| 231 | KR032345 | Erythroneura vitifex voucher BIOUG02718-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 620 | 92.8% | 311.0 | 3.23e-159 | 83.4% |
| 232 | KR044511 | Erythroneura vitifex voucher BIOUG02517-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 311.0 | 3.23e-159 | 83.4% |
| 233 | MG403122 | Dikraneura sp. BIOUG22038-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 311.0 | 3.23e-159 | 83.4% |
| 234 | NC_082903 | Empoascanara hongkongica mitochondrion, complete genome | 668 | 100.0% | 332.0 | 6.84e-171 | 83.3% |
| 235 | KJ089258 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02961-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 327.0 | 4.12e-168 | 83.3% |
| 236 | KR575218 | Erythridula sp. BOLD-2016 voucher BIOUG00917-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 327.0 | 4.12e-168 | 83.3% |
| 237 | KR344728 | Eratoneura flexibilis voucher BIOUG10644-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 327.0 | 4.12e-168 | 83.3% |
| 238 | MF930502 | Eratoneura sp. BIOUG19922-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 327.0 | 4.12e-168 | 83.3% |
| 239 | KJ085298 | Erythroneura sp. BOLD:ABV2644 voucher BIOUG02994-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 327.0 | 4.12e-168 | 83.3% |
| 240 | KJ164186 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03640-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 326.0 | 1.48e-167 | 83.3% |
| 241 | KR583917 | Typhlocybinae sp. BOLD-2016 voucher 08BBHEM-855 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 326.0 | 1.48e-167 | 83.3% |
| 242 | HQ938386 | Graphocephala consobrina voucher PT1_JRE_186 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 653 | 97.8% | 326.0 | 1.48e-167 | 83.3% |
| 243 | OP927030 | Collessius macfarlanei voucher 2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 326.0 | 1.48e-167 | 83.3% |
| 244 | PP596105 | Collessius macfarlanei isolate MD054 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 326.0 | 1.48e-167 | 83.3% |
| 245 | MK055925 | Pandacerus sinuatus voucher INHS124 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 326.0 | 1.48e-167 | 83.3% |
| 246 | KJ083757 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02944-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 325.0 | 5.33e-167 | 83.3% |
| 247 | KJ086837 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02966-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 325.0 | 5.33e-167 | 83.3% |
| 248 | KR034835 | Erythroneura elegans voucher BIOUG00783-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 324.0 | 1.92e-166 | 83.3% |
| 249 | KJ164202 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03443-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 324.0 | 1.92e-166 | 83.3% |
| 250 | KJ167193 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03685-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 324.0 | 1.92e-166 | 83.3% |
| 251 | KJ165937 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03443-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 324.0 | 1.92e-166 | 83.3% |
| 252 | KR033339 | Erythroneura elegans voucher BIOUG00936-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 324.0 | 1.92e-166 | 83.3% |
| 253 | KR037008 | Erythroneura rubrella voucher BIOUG00936-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 324.0 | 1.92e-166 | 83.3% |
| 254 | KJ444267 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03734-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 323.0 | 6.89e-166 | 83.3% |
| 255 | KR034501 | Erythroneura vitifex voucher BIOUG00771-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 320.0 | 3.21e-164 | 83.3% |
| 256 | KR032124 | Erythroneura vitifex voucher BIOUG01643-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 318.0 | 4.15e-163 | 83.3% |
| 257 | KR035862 | Erythroneura vitifex voucher BIOUG01297-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 318.0 | 4.15e-163 | 83.3% |
| 258 | KR041324 | Erythroneura vitifex voucher BIOUG00941-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 318.0 | 4.15e-163 | 83.3% |
| 259 | KR044607 | Erythroneura vitifex voucher BIOUG00936-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 318.0 | 4.15e-163 | 83.3% |
| 260 | KR040080 | Erythroneura vitifex voucher BIOUG01295-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 638 | 95.5% | 317.0 | 1.49e-162 | 83.3% |
| 261 | KJ089823 | Erythroneura rubrella voucher BIOUG02996-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 315.0 | 1.93e-161 | 83.3% |
| 262 | KJ084560 | Erythroneura rubrella voucher BIOUG02980-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 315.0 | 1.93e-161 | 83.3% |
| 263 | KJ165423 | Erythroneura rubrella voucher BIOUG03637-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 315.0 | 1.93e-161 | 83.3% |
| 264 | KJ166545 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03637-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 314.0 | 6.94e-161 | 83.3% |
| 265 | KJ167955 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03637-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 314.0 | 6.94e-161 | 83.3% |
| 266 | KJ166349 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03635-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 628 | 94.0% | 313.0 | 2.50e-160 | 83.3% |
| 267 | KF227365 | Zygina sp. BOLD:AAG4714 voucher ww03291 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 93.9% | 313.0 | 2.50e-160 | 83.3% |
| 268 | KJ083953 | Erythroneura rubrella voucher BIOUG02993-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 312.0 | 8.97e-160 | 83.3% |
| 269 | KJ163335 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02983-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 627 | 93.9% | 312.0 | 8.97e-160 | 83.3% |
| 270 | KJ086679 | Erythroneura rubrella voucher BIOUG02961-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 312.0 | 8.97e-160 | 83.3% |
| 271 | KR573189 | Dikraneura sp. BOLD-2016 voucher BIOUG03380-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 312.0 | 8.97e-160 | 83.3% |
| 272 | KJ163233 | Erythroneura rubrella voucher BIOUG02993-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 312.0 | 8.97e-160 | 83.3% |
| 273 | KR577318 | Erythroneura rubrella voucher BIOUG05894-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 312.0 | 8.97e-160 | 83.3% |
| 274 | KJ167729 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03637-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 622 | 93.1% | 310.0 | 1.16e-158 | 83.3% |
| 275 | NC_082902 | Empoascanara angkhangica mitochondrion, complete genome | 666 | 99.7% | 330.0 | 8.85e-170 | 83.2% |
| 276 | OP643516 | Seriana bacilla isolate zunyi cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.7% | 330.0 | 8.85e-170 | 83.2% |
| 277 | KR583803 | Erythridula sp. BOLD-2016 voucher BIOUG00917-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 324.0 | 1.92e-166 | 83.2% |
| 278 | KR573230 | Erythridula sp. BOLD-2016 voucher BIOUG00552-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 324.0 | 1.92e-166 | 83.2% |
| 279 | KJ087728 | Arboridia sp. BOLD:AAN8285 voucher BIOUG03247-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 324.0 | 1.92e-166 | 83.2% |
| 280 | KR346189 | Erythroneura bakeri voucher BIOUG10644-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 324.0 | 1.92e-166 | 83.2% |
| 281 | KJ164654 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02944-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 324.0 | 1.92e-166 | 83.2% |
| 282 | KJ084139 | Erythroneura sp. BOLD:AAV0161 voucher BIOUG02966-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 323.0 | 6.89e-166 | 83.2% |
| 283 | KR567356 | Erythroneura bakeri voucher BIOUG01295-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 323.0 | 6.89e-166 | 83.2% |
| 284 | MG398707 | Erythroneura bakeri voucher BARS_2016_09_127 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 323.0 | 6.89e-166 | 83.2% |
| 285 | MZ734624 | Hydrotaea borussica isolate C86 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 323.0 | 6.89e-166 | 83.2% |
| 286 | KJ166635 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03686-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 323.0 | 6.89e-166 | 83.2% |
| 287 | KR042508 | Erythroneura vitifex voucher BIOUG01297-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 323.0 | 6.89e-166 | 83.2% |
| 288 | KR035668 | Erythroneura vitifex voucher BIOUG01297-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 322.0 | 2.48e-165 | 83.2% |
| 289 | KM959962 | Coenosia sp. BOLD:AAG1733 voucher BIOUG06734-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 322.0 | 2.48e-165 | 83.2% |
| 290 | KR568774 | Erythroneura elegans voucher BIOUG01293-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 321.0 | 8.91e-165 | 83.2% |
| 291 | KR041241 | Erythroneura elegans voucher BIOUG00906-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 321.0 | 8.91e-165 | 83.2% |
| 292 | KR037689 | Erythroneura vitifex voucher BIOUG01293-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 97.0% | 321.0 | 8.91e-165 | 83.2% |
| 293 | MG401323 | Erythroneura vitifex voucher BIOUG25539-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 316.0 | 5.36e-162 | 83.2% |
| 294 | KR042636 | Erythroneura vitifex voucher BIOUG02716-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 95.2% | 315.0 | 1.93e-161 | 83.2% |
| 295 | MF928809 | Erythroneura rubrella voucher BIOUG03768-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 315.0 | 1.93e-161 | 83.2% |
| 296 | KR031072 | Erythroneura vitifex voucher BIOUG01296-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 315.0 | 1.93e-161 | 83.2% |
| 297 | KR040723 | Erythroneura vitifex voucher BIOUG01516-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 315.0 | 1.93e-161 | 83.2% |
| 298 | KR038671 | Erythroneura vitifex voucher BIOUG01516-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 315.0 | 1.93e-161 | 83.2% |
| 299 | KJ083909 | Erythroneura rubrella voucher BIOUG02986-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 312.0 | 8.97e-160 | 83.2% |
| 300 | MF934819 | Erythroneura elegans voucher BIOUG20491-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 312.0 | 8.97e-160 | 83.2% |
| 301 | KJ089551 | Erythroneura rubrella voucher BIOUG02986-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 312.0 | 8.97e-160 | 83.2% |
| 302 | KR570236 | Erythroneura rubrella voucher BIOUG05894-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 312.0 | 8.97e-160 | 83.2% |
| 303 | KR039549 | Erythroneura elegans voucher BIOUG02716-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 312.0 | 8.97e-160 | 83.2% |
| 304 | KJ092925 | Erythroneura rubrella voucher BIOUG02980-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 312.0 | 8.97e-160 | 83.2% |
| 305 | KR567408 | Dikraneura sp. BOLD-2016 voucher BIOUG03700-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 94.2% | 311.0 | 3.23e-159 | 83.2% |
| 306 | KJ089233 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03447-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 310.0 | 1.16e-158 | 83.2% |
| 307 | NC_082900 | Empoascanara alami mitochondrion, complete genome | 668 | 100.0% | 329.0 | 3.18e-169 | 83.1% |
| 308 | OP643508 | Seriana bacilla isolate leshan cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.7% | 327.0 | 4.12e-168 | 83.1% |
| 309 | OP643517 | Seriana bacilla isolate guilin cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.7% | 327.0 | 4.12e-168 | 83.1% |
| 310 | KP412985 | Emmesomyia grisea isolate VM2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 326.0 | 1.48e-167 | 83.1% |
| 311 | HE577314 | Erythroneurini sp. IBE-GS4 mitochondrial partial COI gene for cytochrome oxidase subunit 1, specimen voucher IBE-GS4 | 657 | 98.4% | 324.0 | 1.92e-166 | 83.1% |
| 312 | KR561052 | Erythroneura sp. BOLD-2016 voucher BIOUG01107-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 98.5% | 322.0 | 2.48e-165 | 83.1% |
| 313 | MZ734490 | Hydrotaea borussica isolate C27 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 652 | 97.6% | 319.0 | 1.15e-163 | 83.1% |
| 314 | JF868353 | Coenosia sp. BBDCN865-10 voucher BIOUG| 652 |
97.6% |
319.0 |
1.15e-163 |
83.1% |
|
| 315 | KR432472 | Coenosia sp. BOLD-2016 voucher BIOUG04221-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 319.0 | 1.15e-163 | 83.1% |
| 316 | MW837549 | Seriana bacilla isolate bijie2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 649 | 97.2% | 319.0 | 1.15e-163 | 83.1% |
| 317 | KR036505 | Erythroneura vitifex voucher BIOUG02517-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 636 | 95.2% | 311.0 | 3.23e-159 | 83.1% |
| 318 | MZ014454 | Eupteryx adspersa mitochondrion, complete genome | 666 | 99.7% | 327.0 | 4.12e-168 | 83.0% |
| 319 | MZ734494 | Hydrotaea borussica isolate C96 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 326.0 | 1.48e-167 | 83.0% |
| 320 | MZ735726 | Hydrotaea borussica isolate D26 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 326.0 | 1.48e-167 | 83.0% |
| 321 | NC_062605 | Cassianeura cassiae mitochondrion, complete genome | 668 | 100.0% | 326.0 | 1.48e-167 | 83.0% |
| 322 | MZ735581 | Hydrotaea borussica isolate C87 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 326.0 | 1.48e-167 | 83.0% |
| 323 | KR561189 | Eratoneura flexibilis voucher BIOUG00935-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 321.0 | 8.91e-165 | 83.0% |
| 324 | MG405026 | Erythroneura sp. BIOUG00936-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 321.0 | 8.91e-165 | 83.0% |
| 325 | KM941291 | Muscidae sp. BOLD:AAP6478 voucher BIOUG03527-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 321.0 | 8.91e-165 | 83.0% |
| 326 | KM926982 | Muscidae sp. BOLD:AAP6478 voucher BIOUG03628-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 321.0 | 8.91e-165 | 83.0% |
| 327 | KM936928 | Muscidae sp. BOLD:AAP6478 voucher BIOUG03628-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 321.0 | 8.91e-165 | 83.0% |
| 328 | JQ576309 | Tachinidae gen. tachJanzen01 sp. Janzen01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 321.0 | 8.91e-165 | 83.0% |
| 329 | KJ091606 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02977-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 321.0 | 8.91e-165 | 83.0% |
| 330 | KR567706 | Eratoneura flexibilis voucher BIOUG01308-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 321.0 | 8.91e-165 | 83.0% |
| 331 | KJ164260 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03639-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 320.0 | 3.21e-164 | 83.0% |
| 332 | MZ735371 | Hydrotaea borussica isolate C85 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 320.0 | 3.21e-164 | 83.0% |
| 333 | KR575868 | Eratoneura sp. BOLD-2016 voucher BIOUG06799-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 320.0 | 3.21e-164 | 83.0% |
| 334 | KF920061 | Neokolla hieroglyphica voucher CNC#HEM401110 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 320.0 | 3.21e-164 | 83.0% |
| 335 | KF919973 | Neokolla hieroglyphica voucher CNC#HEM401111 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 320.0 | 3.21e-164 | 83.0% |
| 336 | MZ734500 | Hydrotaea borussica isolate D2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 320.0 | 3.21e-164 | 83.0% |
| 337 | KR033075 | Neokolla hieroglyphica voucher BIOUG01019-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 320.0 | 3.21e-164 | 83.0% |
| 338 | KJ163066 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03685-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 319.0 | 1.15e-163 | 83.0% |
| 339 | KR577964 | Erythroneura elegans voucher BIOUG01293-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 319.0 | 1.15e-163 | 83.0% |
| 340 | KR042974 | Erythroneura ontari voucher BIOUG00917-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 318.0 | 4.15e-163 | 83.0% |
| 341 | MZ628114 | Lasiomma anthomyinum voucher KWi-267 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 317.0 | 1.49e-162 | 83.0% |
| 342 | KR031996 | Erythroneura vitifex voucher BIOUG01516-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 312.0 | 8.97e-160 | 83.0% |
| 343 | OQ985247 | Ossuaria sichuanensis mitochondrion, complete genome | 668 | 100.0% | 326.0 | 1.48e-167 | 82.9% |
| 344 | NC_082176 | Ossuaria sichuanensis mitochondrion, complete genome | 668 | 100.0% | 326.0 | 1.48e-167 | 82.9% |
| 345 | OP643515 | Seriana bacilla isolate yaan cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.7% | 324.0 | 1.92e-166 | 82.9% |
| 346 | OP643513 | Seriana bacilla isolate chongqing1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.7% | 324.0 | 1.92e-166 | 82.9% |
| 347 | OP643510 | Seriana bacilla isolate neijiang cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 666 | 99.7% | 324.0 | 1.92e-166 | 82.9% |
| 348 | NC_082899 | Empoascanara plamka mitochondrion, complete genome | 666 | 99.7% | 324.0 | 1.92e-166 | 82.9% |
| 349 | NC_084446 | Sophonia nigrilineata mitochondrion, complete genome | 668 | 100.0% | 323.0 | 6.89e-166 | 82.9% |
| 350 | KU932141 | Hydrotaea velutina isolate Hydro_4 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 323.0 | 6.89e-166 | 82.9% |
| 351 | KR567918 | Erythroneura sp. BOLD-2016 voucher BIOUG00935-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 98.5% | 319.0 | 1.15e-163 | 82.9% |
| 352 | KM858217 | Agromyzidae sp. BOLD:ACI4727 voucher BIOUG06718-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 98.5% | 319.0 | 1.15e-163 | 82.9% |
| 353 | KM862580 | Agromyzidae sp. BOLD:ACI4727 voucher BIOUG06762-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 98.5% | 319.0 | 1.15e-163 | 82.9% |
| 354 | KX843906 | Actia pilipennis voucher JP00721 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 355 | KM934068 | Muscidae sp. BOLD:AAP6478 voucher BIOUG04023-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 356 | MG402682 | Dikraneura mali voucher BIOUG30403-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 357 | OM544166 | Cicadellidae sp. voucher BIOUG22479-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 358 | KR562009 | Erythridula sp. BOLD-2016 voucher BIOUG00947-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 359 | KR567005 | Erythridula sp. BOLD-2016 voucher BIOUG00917-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 360 | MZ624463 | Emmesomyia grisea voucher jka11-00809 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 361 | KX843865 | Actia pilipennis voucher MZH_GV.3280 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 362 | KU874670 | Coenosia pilosissima voucher UAM:Ento:152165 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 363 | LC782683 | Actia pilipennis Acp_17062007 mitochondrial CO1 gene for cytochrome c oxidase subunit 1, partial cds | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 364 | MZ627039 | Emmesomyia grisea voucher KWi-278 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.9% |
| 365 | KR032716 | Tylozygus bifidus voucher BIOUG01019-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 317.0 | 1.49e-162 | 82.9% |
| 366 | MG400778 | Erythridula sp. BIOUG21971-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 317.0 | 1.49e-162 | 82.9% |
| 367 | JF866991 | Hydrotaea scambus voucher BIOUG| 656 |
98.2% |
317.0 |
1.49e-162 |
82.9% |
|
| 368 | HM412548 | Hydrotaea scambus voucher BIOUG| 656 |
98.2% |
317.0 |
1.49e-162 |
82.9% |
|
| 369 | JF867568 | Coenosia sp. BBDCM975-10 voucher BIOUG| 652 |
97.6% |
316.0 |
5.36e-162 |
82.9% |
|
| 370 | JF868360 | Coenosia sp. BBDCN873-10 voucher BIOUG| 652 |
97.6% |
316.0 |
5.36e-162 |
82.9% |
|
| 371 | KU146912 | Lydina aenea voucher JP00217 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 316.0 | 5.36e-162 | 82.9% |
| 372 | HM417308 | Phasia sp. BOLD:AAG2158 voucher BIOUG| 652 |
97.6% |
316.0 |
5.36e-162 |
82.9% |
|
| 373 | HM434553 | Argyrochaetona sp. Janzen04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 313.0 | 2.50e-160 | 82.9% |
| 374 | KJ092896 | Erythroneura rubrella voucher BIOUG02983-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 637 | 95.4% | 310.0 | 1.16e-158 | 82.9% |
| 375 | OQ404948 | Arboridia sp. 1 NZ-2023a mitochondrion, complete genome | 668 | 100.0% | 323.0 | 6.89e-166 | 82.8% |
| 376 | KY039129 | Illinigina sp. EMHAU-15062817 mitochondrion, partial genome | 666 | 99.7% | 321.0 | 8.91e-165 | 82.8% |
| 377 | MN910279 | Eupteryx minuscula mitochondrion, complete genome | 666 | 99.7% | 321.0 | 8.91e-165 | 82.8% |
| 378 | OM048922 | Seriana sp. 'barna' mitochondrion, complete genome | 666 | 99.7% | 321.0 | 8.91e-165 | 82.8% |
| 379 | KR584641 | Eratoneura flexibilis voucher BIOUG01294-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 320.0 | 3.21e-164 | 82.8% |
| 380 | KR581832 | Eratoneura sp. BOLD-2016 voucher BIOUG01797-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 319.0 | 1.15e-163 | 82.8% |
| 381 | KR564219 | Eratoneura flexibilis voucher BIOUG01293-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.8% |
| 382 | KR584212 | Eratoneura flexibilis voucher BIOUG01295-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.8% |
| 383 | MG405303 | Eratoneura flexibilis voucher BIOUG00906-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.8% |
| 384 | KR569374 | Eratoneura flexibilis voucher BIOUG01293-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.8% |
| 385 | HQ978672 | Hemiptera sp. BOLD:AAN8418 voucher BIOUG| 656 |
98.2% |
317.0 |
1.49e-162 |
82.8% |
|
| 386 | KR036606 | Neokolla hieroglyphica voucher BIOUG00937-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 317.0 | 1.49e-162 | 82.8% |
| 387 | KY835287 | Cicadellidae sp. BIOUG02381-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 317.0 | 1.49e-162 | 82.8% |
| 388 | KR579358 | Neokolla hieroglyphica voucher BIOUG00917-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 317.0 | 1.49e-162 | 82.8% |
| 389 | KR045183 | Erythroneura ontari voucher BIOUG00552-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 315.0 | 1.93e-161 | 82.8% |
| 390 | KR583819 | Erythroneura sp. BOLD-2016 voucher BIOUG01308-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 314.0 | 6.94e-161 | 82.8% |
| 391 | GU689843 | Diptera sp. BOLD:AAG1768 voucher BIOUG| 656 |
98.2% |
314.0 |
6.94e-161 |
82.8% |
|
| 392 | KF920265 | Tylozygus bifidus voucher CNC#HEM401171 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 314.0 | 6.94e-161 | 82.8% |
| 393 | HM891689 | Hydrotaea pilitibia voucher BUIC-CHU0658 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 314.0 | 6.94e-161 | 82.8% |
| 394 | OK065221 | Azelia nebulosa voucher MZH_GV.3438 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 313.0 | 2.50e-160 | 82.8% |
| 395 | HM417558 | Phasia sp. BOLD:AAG2158 voucher BIOUG| 652 |
97.6% |
313.0 |
2.50e-160 |
82.8% |
|
| 396 | EF182337 | Siphosturmia sp. rafaeliDHJ08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 313.0 | 2.50e-160 | 82.8% |
| 397 | MZ624531 | Azelia nebulosa voucher JKA12-1948 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 313.0 | 2.50e-160 | 82.8% |
| 398 | GU689844 | Diptera sp. BOLD:AAG1768 voucher BIOUG| 651 |
97.5% |
312.0 |
8.97e-160 |
82.8% |
|
| 399 | MG097774 | Coenosia sp. BIOUG25594-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.9% | 311.0 | 3.23e-159 | 82.8% |
| 400 | KR039583 | Erythroneura vitifex voucher BIOUG01643-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 310.0 | 1.16e-158 | 82.8% |
| 401 | NC_063609 | Lydina aenea isolate DM1002 mitochondrion, complete genome | 668 | 100.0% | 320.0 | 3.21e-164 | 82.7% |
| 402 | NC_086574 | Linnaemya omega mitochondrion, complete genome | 668 | 100.0% | 320.0 | 3.21e-164 | 82.7% |
| 403 | MN555665 | Hydrotaea velutina voucher KEIB:DIP_00243 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 320.0 | 3.21e-164 | 82.7% |
| 404 | KM868430 | Agromyzidae sp. BOLD:ACI4727 voucher BIOUG06741-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 315.0 | 1.93e-161 | 82.7% |
| 405 | KR561362 | Erythroneura sp. BOLD-2016 voucher BIOUG00947-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 315.0 | 1.93e-161 | 82.7% |
| 406 | KM942009 | Muscidae sp. BOLD:AAP6478 voucher BIOUG04377-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 315.0 | 1.93e-161 | 82.7% |
| 407 | HM435805 | Fucellia tergina voucher BIOUG| 657 |
98.4% |
315.0 |
1.93e-161 |
82.7% |
|
| 408 | KR035343 | Neokolla hieroglyphica voucher 22-4-128 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 314.0 | 6.94e-161 | 82.7% |
| 409 | KF920227 | Neokolla hieroglyphica voucher CNC#HEM401109 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 314.0 | 6.94e-161 | 82.7% |
| 410 | GU689841 | Diptera sp. BOLD:AAG1771 voucher BIOUG| 656 |
98.2% |
314.0 |
6.94e-161 |
82.7% |
|
| 411 | MF885642 | Coenosia sp. BIOUG21651-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 313.0 | 2.50e-160 | 82.7% |
| 412 | KX844061 | Lydina aenea voucher JKA12-0947 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 313.0 | 2.50e-160 | 82.7% |
| 413 | KX844377 | Clairvillia biguttata voucher JP00109 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 313.0 | 2.50e-160 | 82.7% |
| 414 | HQ945418 | Tachinidae sp. BOLD:AAG6797 voucher gvc12212-1L cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 313.0 | 2.50e-160 | 82.7% |
| 415 | JF869438 | Lasiomma sp. BBDCQ090-10 voucher BIOUG| 651 |
97.5% |
312.0 |
8.97e-160 |
82.7% |
|
| 416 | MG398286 | Erythroneura sp. BIOUG22017-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 312.0 | 8.97e-160 | 82.7% |
| 417 | KR039511 | Erythroneura ontari voucher BIOUG01516-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 312.0 | 8.97e-160 | 82.7% |
| 418 | KR562184 | Erythroneura ontari voucher BIOUG00935-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 312.0 | 8.97e-160 | 82.7% |
| 419 | MK055906 | Ipoides honiala voucher INHS15 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 311.0 | 3.23e-159 | 82.7% |
| 420 | KR567574 | Dikraneura sp. BOLD-2016 voucher 10BBCHEM-0565 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 311.0 | 3.23e-159 | 82.7% |
| 421 | KR672391 | Fucellia nr. ariciiformis BOLD-2016 voucher CHU05-FLY-164 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.9% | 311.0 | 3.23e-159 | 82.7% |
| 422 | KX844194 | Phasia barbifrons voucher JP00503 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.7% | 310.0 | 1.16e-158 | 82.7% |
| 423 | KR571682 | Eratoneura flexibilis voucher BIOUG01297-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 318.0 | 4.15e-163 | 82.6% |
| 424 | OZ174201 | Azelia nebulosa genome assembly, organelle: mitochondrion | 668 | 100.0% | 317.0 | 1.49e-162 | 82.6% |
| 425 | KU932135 | Hydrotaea irritans isolate Hydro_21 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 317.0 | 1.49e-162 | 82.6% |
| 426 | NC_083970 | Isomyia nebulosa isolate Cangyuan mitochondrion, complete genome | 668 | 100.0% | 317.0 | 1.49e-162 | 82.6% |
| 427 | MN521174 | Hydrotaea basdeni voucher BIOUG26545-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 315.0 | 1.93e-161 | 82.6% |
| 428 | KR581544 | Erythridula sp. BOLD-2016 voucher BIOUG03852-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 314.0 | 6.94e-161 | 82.6% |
| 429 | HM389106 | Spilogona opaca voucher BUIC-CHU0395 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 314.0 | 6.94e-161 | 82.6% |
| 430 | KX161559 | Calliphora vomitoria isolate P9B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 98.5% | 313.0 | 2.50e-160 | 82.6% |
| 431 | PQ246858 | Emmesomyia sp. voucher CEC248 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 657 | 98.4% | 312.0 | 8.97e-160 | 82.6% |
| 432 | KM930654 | Muscidae sp. BOLD:AAP6478 voucher BIOUG03702-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 312.0 | 8.97e-160 | 82.6% |
| 433 | JF868149 | Coenosia pilosissima voucher BIOUG| 657 |
98.4% |
312.0 |
8.97e-160 |
82.6% |
|
| 434 | KR568251 | Erythridula sp. BOLD-2016 voucher BIOUG00917-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 312.0 | 8.97e-160 | 82.6% |
| 435 | GU689842 | Diptera sp. BOLD:AAG1768 voucher BIOUG| 656 |
98.2% |
311.0 |
3.23e-159 |
82.6% |
|
| 436 | MG095618 | Hydrotaea scambus voucher BIOUG01411-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 311.0 | 3.23e-159 | 82.6% |
| 437 | MZ624958 | Hydrotaea velutina voucher JKA12-0868 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 311.0 | 3.23e-159 | 82.6% |
| 438 | HM891773 | Spilogona opaca voucher BUIC-CHU0764 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 310.0 | 1.16e-158 | 82.6% |
| 439 | HQ548404 | Siphosturmia sp. rafaeliDHJ08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 310.0 | 1.16e-158 | 82.6% |
| 440 | DQ647346 | Chrysomya semimetallica voucher JW42.2 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 310.0 | 1.16e-158 | 82.6% |
| 441 | KC500007 | Spilogona opaca voucher BUIC-CHU1026 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 310.0 | 1.16e-158 | 82.6% |
| 442 | JQ575948 | Tachinidae gen. tachJanzen01 sp. Janzen01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 310.0 | 1.16e-158 | 82.6% |
| 443 | KM641521 | Muscidae sp. BOLD:AAP8149 voucher BIOUG04935-F03 cytochrome oxidase subunit 1 (COI) gene, promoter region and partial cds; mitochondrial | 652 | 97.6% | 310.0 | 1.16e-158 | 82.6% |
| 444 | HM417217 | Phasia sp. BOLD:AAG2158 voucher BIOUG| 652 |
97.6% |
310.0 |
1.16e-158 |
82.6% |
|
| 445 | EF182373 | Siphosturmia sp. rafaeliDHJ08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 310.0 | 1.16e-158 | 82.6% |
| 446 | JN291045 | Diptera sp. BOLD:AAP8149 voucher BIOUG| 652 |
97.6% |
310.0 |
1.16e-158 |
82.6% |
|
| 447 | JQ246692 | Rhinia sp. MATM-2012 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 317.0 | 1.49e-162 | 82.5% |
| 448 | JQ976724 | Empoasca vitis clone 54 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 317.0 | 1.49e-162 | 82.5% |
| 449 | JQ976727 | Empoasca vitis clone 57 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 317.0 | 1.49e-162 | 82.5% |
| 450 | JQ976726 | Empoasca vitis clone 56 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 317.0 | 1.49e-162 | 82.5% |
| 451 | KY001916 | Calliphora vomitoria isolate CSU150701CBCV9 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 314.0 | 6.94e-161 | 82.5% |
| 452 | MZ750790 | Hydrotaea meridionalis isolate D82 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 314.0 | 6.94e-161 | 82.5% |
| 453 | KY001918 | Calliphora vomitoria isolate CSU150701CBCV11 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 314.0 | 6.94e-161 | 82.5% |
| 454 | MN521202 | Hydrotaea basdeni voucher BIOUG26545-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 312.0 | 8.97e-160 | 82.5% |
| 455 | HM860670 | Fucellia nr. ariciiformis JWDCA604-10 voucher BIOUG| 657 |
98.4% |
312.0 |
8.97e-160 |
82.5% |
|
| 456 | KR565550 | Erythroneura sp. BOLD-2016 voucher BIOUG01308-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 312.0 | 8.97e-160 | 82.5% |
| 457 | KR565151 | Eratoneura flexibilis voucher BIOUG01297-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 312.0 | 8.97e-160 | 82.5% |
| 458 | JF877124 | Fucellia tergina voucher BIOUG| 657 |
98.4% |
312.0 |
8.97e-160 |
82.5% |
|
| 459 | KR576755 | Cicadellidae sp. BOLD-2016 voucher BIOUG01293-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 312.0 | 8.97e-160 | 82.5% |
| 460 | PP819594 | Idioscopus sp. 2 QLX-2023a isolate xql46 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 311.0 | 3.23e-159 | 82.5% |
| 461 | KF919794 | Neokolla hieroglyphica voucher CNC#HEM401103 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 311.0 | 3.23e-159 | 82.5% |
| 462 | KR040207 | Neokolla hieroglyphica voucher BIOUG01487-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 311.0 | 3.23e-159 | 82.5% |
| 463 | EF182408 | Siphosturmia sp. rafaeliDHJ08 voucher DHJPAR0003355 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 662 | 99.1% | 311.0 | 3.23e-159 | 82.5% |
| 464 | KY031768 | Isomyia electa strain 505C-1 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 311.0 | 3.23e-159 | 82.5% |
| 465 | EF182343 | Siphosturmia sp. rafaeliDHJ08 voucher DHJPAR0003381 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 662 | 99.1% | 311.0 | 3.23e-159 | 82.5% |
| 466 | KX161560 | Calliphora vomitoria isolate P9D4 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 98.5% | 310.0 | 1.16e-158 | 82.5% |
| 467 | KR669251 | Lasiomma atricaudatum voucher 10PROBE-16243 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 98.5% | 310.0 | 1.16e-158 | 82.5% |
| 468 | MW200843 | Compsomyiops verena voucher QCAZI_212237 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 310.0 | 1.16e-158 | 82.5% |
| 469 | JN302692 | Lasiomma atricaudum voucher BIOUG| 658 |
98.5% |
310.0 |
1.16e-158 |
82.5% |
|
| 470 | HM881171 | Icelia sp. ASCRT348-10 voucher INB0003565506 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 310.0 | 1.16e-158 | 82.5% |
| 471 | OQ469424 | Empoascanara dissimilis isolate yunnan cytochrome c oxidase subunit I (COX1) gene, complete cds; mitochondrial | 666 | 99.7% | 315.0 | 1.93e-161 | 82.4% |
| 472 | HQ248105 | Verticia orientalis voucher WVU2009-017-32 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 314.0 | 6.94e-161 | 82.4% |
| 473 | PQ373333 | Hydrotaea kashmirana voucher ZMUM:HydKas_NEP_sep2017 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 314.0 | 6.94e-161 | 82.4% |
| 474 | MT410826 | Hydrotaea irritans isolate DM831 mitochondrion | 668 | 100.0% | 314.0 | 6.94e-161 | 82.4% |
| 475 | KJ085776 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03070-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 311.0 | 3.23e-159 | 82.4% |
| 476 | KR562150 | Erythridula sp. BOLD-2016 voucher BIOUG01487-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 310.0 | 1.16e-158 | 82.4% |
| 477 | KM868631 | Agromyzidae sp. BOLD:ACI4727 voucher BIOUG06744-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 658 | 98.5% | 310.0 | 1.16e-158 | 82.4% |
| 478 | ON022032 | Eupteryx sp. mitochondrion, complete genome | 666 | 99.7% | 312.0 | 8.97e-160 | 82.3% |
| 479 | PP392958 | Anopheles coustani sensu lato sp. isolate C2 mitochondrion, complete genome | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 480 | MG969489 | Calliphora vomitoria isolate Vo2 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 481 | KY001915 | Calliphora vomitoria isolate CSU150701CBCV8 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 482 | KY001917 | Calliphora vomitoria isolate CSU150701CBCV10 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 483 | MW564237 | Calliphora vomitoria isolate Lhasa, Tibet, China cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 484 | KF918997 | Calliphora vomitoria voucher NICC0028_11617963 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 485 | MW564253 | Calliphora uralensis isolate Lhasa,Tibet,China cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 486 | MW565978 | Calliphora vomitoria voucher CSU201222FT2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 487 | MW566104 | Calliphora uralensis voucher CSU201222WLE3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 488 | NC_053677 | Calliphora uralensis voucher CSU19111920 mitochondrion, complete genome | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 489 | KY001919 | Calliphora vomitoria isolate CSU150701CBCV12 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 490 | KU932127 | Azelia cilipes isolate Hydro_9 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 491 | KY001914 | Calliphora vomitoria isolate CSU150701CBCV7 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 492 | MW565994 | Calliphora uralensis voucher CSU201222WLE2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 493 | MT628572 | Azelia cilipes mitochondrion, partial genome | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 494 | MW566088 | Calliphora vomitoria voucher CSU201222FT3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.3% |
| 495 | MZ396076 | Neokolla hieroglyphica isolate 44A cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.2% |
| 496 | MN793266 | Culex bidens voucher Cx_bidens_Cba_16_56 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.2% |
| 497 | NC_041657 | Palesisa nudioculata mitochondrion, complete genome | 668 | 100.0% | 311.0 | 3.23e-159 | 82.2% |
| 498 | NC_037822 | Culex declarator clone SP36_100 mitochondrion, complete genome | 668 | 100.0% | 311.0 | 3.23e-159 | 82.2% |
| 499 | AF295549 | Compsomyiops callipes cytochrome oxidase subunit 1 (COI) gene, partial cds; tRNA-Leu gene, complete sequence; and cytochrome oxidase subunit 2 (COII) gene, partial cds; mitochondrial genes for mitochondrial products | 668 | 100.0% | 311.0 | 3.23e-159 | 82.2% |
| 500 | MH931446 | Culex bidens isolate LCA67 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 668 | 100.0% | 311.0 | 3.23e-159 | 82.2% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
This sections shows the taxa of interest specified by the submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity |
|---|---|---|---|---|---|
| Empoascanara | - | - | - | - | - |
See the Database coverage section to see database coverage for taxa of interest.
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
The target taxa include candidate species, the preliminary morphology ID, and any taxa of interest provided by the submitter. Each of these taxa are independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of the target taxon. Insufficient coverage of a taxon can result in that taxon not be correctly identified as the taxonomic identity of the sample. For example, if the sample is Homo sapiens, but Homo sapiens sequences are not included in the reference database, the analysis will be unable to identity Homo sapiens as the correct taxonomic identity, and will most likely assign the closest relative with reference data as the taxonomic identity.
Preliminary ID
Taxa of interest
Database coverage
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 20 sequences in the reference database for Empoascanara at the given locus COI.
Global occurrence records for Empoascanara.
Note that the occurrence data are not exhaustive, and it is possible for this species to occur in regions not shown on the map.
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3A:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Database coverage
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 20 sequences in the reference database for Empoascanara at the given locus COI.
Global occurrence records for Empoascanara.
Note that the occurrence data are not exhaustive, and it is possible for this species to occur in regions not shown on the map.
Flag 5.2C:
The database has poor support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3A:
Probability that a different related species from the country of origin is the true taxonomic identity: LOW
Reasoning: All species in genus from country of origin have reference sequence(s) for this locus
/ (%) sequence records were found in the reference database for:
Number of GenBank records at locus COI
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |